April 2008
FedEx | Track →
Reminders
Undergraduate Research Symposium steadily approaching. Monthy FTR shin-dig tomorrow AM.
CEEH Microarray Services Unit →
PANTHER - Classifications of Genes and Proteins →
Biological Information Resource v2.5 →
Phylogenomics: Improving Functional Predictions... →
UPS: qpx →
I have done a little looking around…hard to sift through everything but it seems that the spotted fever and typhus groups are related to only genus Rickwettsia (see table on one of below web sites and notice that genus rickettsia is a heading above spotter fever and typhus group designations)….Also they (genus rickettsia) are free within cytoplasm unlike members of a newly proposed...
"PRIM2" input interface →
Washington Weekend →
wet genes: minor updates →
Amplify for MacOS X →
Friedman Plate01 added to BLAST Server →
What Adelaide is up to.....
I am investigating the potential pathways of highly unsaturated fatty acid conversions in local populations of copepods found in the Puget Sound region of Washington State, USA. A variety of copepod species were collected and their DNA and RNA were extracted. Primers were developed for the most common desaturases responsible for HUFA conversions: delta-6, delta-5, etc. One of the challenges...
"Stop your grinnin, and drop your linen..."
It’s time for the April installment of the monthly Second Floor FTR Shindig. It will be hosted by the Young Lab on Tuesday, April 29th. We will start mingling around 9 AM, in the FTR conference room, and will proceed to the presentations whenever the ferry delivers Dr. Young. And I heard a rumor that Sam was bringing beer….? JR
Watch
Abalone_Bacteria_library →
Watch(via Google Video)
greengenes.lbl.gov - Aligned 16S rDNA →
WatchMapping polymorphisms in 16S ribosomal RNA from Sandra Porter on Vimeo.
SIMoN -- Special Status Species: Black Abalone →
Taylor Shellfish Farms Hatchery →
Google Docs - blast_rhodes_041208 →
Just took a look at these results, and was encouraged by the positive 18S hit, this means the template is working correctly, as well as the PCR. However, this was not the target of my investigations.
Watch
Katie's genes
So what genes are being examined in Katie’s project. Well we have this one… GACGAGACACGTTTTGGAGAGCTGCCATTTTGTTGACTTGTGCACCTATA GAGCGGAAGCCGTGATACAGCCTTCGACGGATAACTAGTGTTGGGGGAGA GACTGTACTCACAATTTTGTACCATATAATTATCTTCGAACGGGAGAAGT GATCAATTGACTAATTATTCATCATGGGCGACAGGGAAGAATGTATCGCG AACGCCAAACTGGCGGAGCAGGTCGAACGATTCGACGACATGGTTGCCAA AATGAAGGTAGTTGCAACCGGTAGTGATCCTCTGAATGAAGAAGAGAGAA...
Google Docs - blast_rhodes_041108 →
Ologeez! - How It Works →
2 tags
Aging fish
Salmon die, however there appears to be distinct differences related to environment and more interestingly, genetics. What genes might be driving this? Maybe homologs of genes found over here, here, or there. photo via foist
Watch
Faster, Cooler DNA gels | Bitesize Bio →
Identification of ompR from a rickettsia-like... →
Take a look at this Steph, pretty neat
Rapid accumulation of an interleukin 17 homolog... →
Back again
Well, I’m back, time to explore the wonderful world of q-PCR. I have 20 abalone digestive samples to run with my OMPA primers. Half are from Carmel, half from San Nicolas Island. Within thin each population, five have been exposed, 5 are naive. The San Nic population has demonstrated some resistance to RLP. If all goes well, OMPA will only be expressed in the exposed abalone, and it will be...
last quarter!
So it’s the beginning of the end, so to speak. It’s shaping up to be the easiest quarter, so I hope to spend some more time working on my capstone! I did a qPCR thursday on several different tissues to see where tollip is expressed the most. Unfortunately it didn’t work… hope to find out why next week. I did reverse transcription on RNA extracted from digestive gland...
UPS: more Bioline, See-Gene?? →
Effects of traditional Chinese medicine on immune... →
Toll-Like Receptors « MicrobiologyBytes →
Pathogens and Proteins « MicrobiologyBytes →
“a bacteria that lives exclusively inside a eukaryotic protist, which in turn...”
– Life, diverse and diversifying
Fwd: FTR Water
Hi all, I [prof Horner-Devine] am updating my list of water cooler users, and I need to collect some cash. Please let me know if you no longer want to use the cooler. In the meantime, the folks who have been signed up - please leave a check or cash for me for $30 under my door sometime this week. If you are not already using the water, but you would like to do so, please just let me know. Please...
Watch