September 2008
1 tag
Science's SAGE KE: Science of Aging Knowledge... →
Watch
FISH404: Diseases of Aquatic Organisms →
Watchmaybe next month we will be at this level :)
Play With Spider - Flash 3D - OneMotion.com →
How SDS-PAGE works | Bitesize Bio →
What's your pet system for organizing articles... →
nice array of comments on how to organize articles. my pick is still Papers
New Student Orientation 2008
Here is a brief synopsis of the new graduate student orientation week: • 9/16 to 9/17: CIDR TA Conference (http://depts.washington.edu/cidrweb/events/TAConference.html) Various times and locations (see website) o Strongly recommended if you will be a new Teaching Assistant this year. The SAFS recommended workshops are at...
Mozy: Recommended Backup Option →
https://mozy.com/?code=3J5KTI
Wiki!
Well, well, look who’s back in the house! That’s right, blogger extraordinair, Sam! I have successfully survived getting hitched and have returned to normal life without stress. Thank you to Steven and Caroline for their wonderful video montage of our wedding. That was pretty creative, particularly with their song selection!
Now, let’s get back to the good stuff. The lab...
Leverage the power of multi-core processors... →
Watch
Moving Online at Bench Press →
Watch
2 tags
Open science
A prior post brought up the concept of open science and networking, two things that are closely linked. To take one thing first, I thought I would list avenues by which we attempt to be “open”— whether this openess is bettering science is worthy of debate but that is the driving force. A secondary benefit of this is that it becomes easier to track progress (or lack there of) locally....
SeaFans just needed a little more heat
While Rachel was taking breaks from tracking down some cephlapods she managed a PCR on the SeaFan samples that have mysteriously been giving us problems. Not pretty but we have some bands. Not sure about those high molecular weigt bands. What is new, well did another pre-heat (30 min @ 95) 50ul Immunomix. Picture you ask? Related to the post below on open access and streamlining - saving time and...
1 tag
Mid-week focus
While one might suppose the lab activity stopped, we are trying to push through while Sam lives it up far abroad. As summed up below I spoke with Byron and followed that up with a conversation with Shannon (MS data analysis) and have a better understanding of the process / output. Overall very happy with the first shot, could have been much worse. Two priorities on this front will be getting...
1 tag
ProteinProphet →
Results from Mass Spec of C. gigas protein spot — not too bad for the first shot
1 tag
WatchSam and Anne’s Wedding - (some extreme iso-electrical focusing)
1 tag
Keratin feedback
We had a little keratin in our oysters and while this is not too unusual we need to be extra paranoid on our next run. B. Gallis provided some helpful tips:
1. Wash gel box
2. Do not re use gloves (if you do, do not touch them)
3. When extracting> clean plates, forceps, etc with v. good water and ethanol.
4. Focus, Focus, Focus..
Maybe next week we will give it another shot!
2 tags
The Molluskan Zodiac →
Octopus bimaculoides care sheet →
WatchIn honor of Sam (and Anne’s) Wedding this Weekend!
Sequence files
Wet Genes site for SAFS sequence processing has been updated to include online file submission.
1 tag
Keeping an Octopus →
1 tag
Sources of Live Cephalopods - The Cephalopod Page →
1 tag
Watch(via Google Video)
1 tag
PLoS ONE: Extensive Adaptive Changes Occur in the... →
think Vt and oyster blood
1 tag
Vibrio FliM Fw →
srid: 472, primersequence: TGATTACCATGGAAGCGCGT, bp: 20, organism: Vibrio , gene: FliM
Vibrio FliM Rv →
srid: 471, primersequence: GCGTGCTCAGGCATTTCAATC, bp: 21, organism: Vibrio, gene: FliM
2 tags
Update
There isn’t much to report on the octopus mucus front. I’ve been out of town for a week in beautiful Bend, Oregon, and progress is still slow because of a particularly exclusive freeze drier. After my last 2D gel it was pretty clear that the new mucus samples need to be concentrated further, so we’d like to get them freeze dried before we attempt any more gels. In the meantime I...
